Induction of the human CDC45 gene promoter activity by natural compound trans‑resveratrol
- Authors:
- Published online on: April 4, 2024 https://doi.org/10.3892/mmr.2024.13216
- Article Number: 92
-
Copyright: © Arakawa et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
Introduction
Cell division cycle 45 (CDC45) is a component of the CMG complex, which contains MCM2-7 and GINS and plays a role as an essential helicase in DNA replication in eukaryotic cells (1). The CDC45 protein, recruiting single-stranded DNA binding protein replication protein A (RPA) (2), is required for restriction of excess processing of the replication fork (3–5). In yeast, DNA damage induces Rad53, of which the homologue is CHCK2 in human cells and which causes phosphorylation of CDC45 to inhibit both initiation and elongation processes of the DNA replication (6). In addition, it has been shown that the human DNA helicase B (HDHB/HELB), which plays a part in DNA end resection (7), associates with RPA (8,9) and CDC45 (10). At the process of inter-strand crosslinks, FANCM associates with the CDC45-MCM complex while the GINS are released (11). Downregulation of GINS complex formation inhibits DNA replication, arresting the cell cycle at G1 phase (12). On the other hand, overexpression of the CDC45 causes replication stress, including S-phase arrest, replication fork stalling and eventually apoptosis (13). These observations suggest that well balanced expression of the CDC45, functioning together with HELB, RPA and CHEK2, is essential for the regulation of DNA replication initiation, which also affects the DNA repair system in eukaryotes. However, it is not fully understood how the CDC45 gene expression is controlled. To elucidate the gene expression regulatory mechanism, 556-bp of the 5′-upstream region of the CDC45 gene was cloned by PCR and it was ligated into a luciferase (Luc) expression plasmid, which was used for transfection and Luc reporter assay. The results showed that the 556-bp functions as a promoter with response to trans-resveratrol (Rsv) in HeLa S3 cells. Analysis of the sequence using the NCBI human genomic database revealed that the 556-bp is a bidirectional promoter, containing not only the putative transcription start site (TSS) of the CDC45 gene, but also the oppositely transcribed ubiquitin recognition factor in the ER-associated degradation 1-encoding UFD1 gene (14). Notably, the UFD1 protein is involved in the CMG helicase disassembly process (15). The 556-bp human CDC45 gene promoter contains duplicated GGAA and GC-box elements (16,17), which are the target of the ETS family (18) and Sp1/Sp3 (19) transcription factor (TF) proteins, respectively. Previous studies showed that they cooperatively regulate the transcription of the HELB and MCM4 genes in response to Rsv in HeLa S3 cells (20,21).
In the present study, various deletion/point mutations were made on the 556-bp region to show which elements are essential for the promoter activity with the positive response to natural compound Rsv. Additionally, reverse transcription-quantitative (RT-q) PCR and western blotting were performed to examine whether the transcripts and the translates of the CDC45 gene accumulated following Rsv treatment of HeLa S3 cells. Collectively, the present study aimed to reveal molecular mechanisms that drive the CDC45 gene promoter in accordance with induction of the HELB and MCM4 gene expression in Rsv treated HeLa S3 cells.
Materials and methods
Materials
trans-Resveratrol (Rsv; cat. no. CAS501-36-0) was purchased from Cayman Chemical Company (20–22).
Cells and cell culture
Human cervical carcinoma (HeLa S3) cells (Institute of Medical Science, Tokyo University) (23) were grown in Dulbecco's modified Eagle's medium (DMEM; Nacalai Tesque, Inc.) (20–22) and supplemented with 10% fetal bovine serum (FBS; Biosera) and penicillin-streptomycin at 37°C in a humidified atmosphere with 5% CO2.
Construction of Luc reporter plasmids
The Luc reporter plasmids, carrying 556-bp, which contains a TSS of the human CDC45 gene, was constructed by the slight modification of a previously described procedure (20–22,24). Briefly, PCR was performed with the hCDC45-9123/AhCDC45-9679 primer pair (Table I) and genomic DNAs that were extracted from HeLa S3 cells. The amplified DNA fragment was treated with HindIII and then ligated into the multi-cloning site of pGL4.10[luc2] (Promega Corporation). The resultant plasmids, containing the 556-bp fragment in a correct orientation, was named pGL4-CDC45-556. Similarly, other Luc reporter plasmids were constructed by ligating a PCR-amplified DNA fragment into the HindIII site of pGL4.10[luc2]. The sense and anti-sense primers used for the amplification of the DNA fragments are shown in Table II. Nucleotide sequences were confirmed by a DNA sequencing service (FASMAC, Greiner Japan Inc.) with Rv or GL primers (20–22,24). The Luc reporter plasmids, pGL4-HDHB and pGL4-MCM4, were used as Rsv-inducible positive control vectors (20,21).
Transcription factor binding sequence analysis
The nucleotide sequence of the cloned 556-bp DNA fragment was subjected to analysis of human transcription factor binding elements by JASPAR 2020 (http://jaspar2020.genereg.net/).
Transient transfection and Luc assay
Luc reporter plasmids were transfected into HeLa S3 cells by a DEAE-dextran method in 96-well plates as previously described (25) and after 24 h of transfection, the culture medium was changed to Rsv (20 µM) containing DMEM with 10% FBS. After a further 24 h of incubation, cells were collected and lysed with 100 µl of 1X cell culture lysis reagent, containing 25 mM Tris-phosphate (pH 7.8), 2 mM DTT, 2 mM 1,2-diaminocyclohexane-N,N,N',N',-tetraacetic acid, 10% glycerol and 1% Triton X-100 and then mixed and centrifuged at 12,000 × g for 5 sec. The appropriate concentration and duration of treatment with Rsv had been determined by MTS and Luc assay, respectively (24). The supernatant was stored at −80°C. The Luc assay was performed with a Luciferase assay system (Promega Corporation) and relative Luc activities were calculated as described previously (25).
Western blotting
Cells were collected after Rsv-treatment and lysed in a RIPA buffer (20 mM Tris-HCl (pH 7.4), 0.1% SDS, 1% TritonX100, and 1% sodium deoxychlate). Protein amount was analyzed with Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, Inc.) according to the manufactures protocol. After SDS-PAGE (15% acrylamide) (15–25 µg proteins/lane) and blotting onto a PVDF (Immobilon-P) membrane as previously described (20–22), Blocking was carried out in a Blocking solution, which is a TBS containing 1% Skim milk (Megmilk Snow Brand), at 4°C for 15 h. Western blot analysis was carried out with antibodies against CDC45 (cat. no. 11881, Cell Signaling, Danvers, MA) (1:1,000), and β-actin (cat. no. A5441; MilliporeSigma) (1:1,000) at 20°C for 1 h, followed by the incubation with horseradish peroxidase-conjugated anti-rabbit (cat. no. A0545) (1:10,000) or anti-mouse IgG (cat. no. A9917) secondary antibodies (Sigma-Aldrich; Merck KGaA) (1:10,000) at 20°C for 1 h in a TBS containing 1% TritonX100 and 2.5% Skim milk. Signal intensities were detected with ImmunoStar LD (FUJIFILM Wako Pure Chemical Corporation) and quantified with a ChemiDoc image analysis system and ImageLab 6.0 software (Bio-Rad Laboratories, Inc.).
RT-qPCR
RNA extraction, cDNA synthesis, and qPCR were performed according to the manufacturer's protocol. First-strand cDNAs were synthesized with ReverTra Ace (Toyobo Life Science), random primers (Takara Bio, Inc.) and total RNAs extracted from HeLa S3 cells, which were cultured 1 to 5×106 cells/φ 10 cm dish. PCR analysis was carried out using a Mx3000P Real-Time qPCR System (Stratagene; Agilent Technologies, Inc.) (20–22). cDNAs were added to the Thunderbird Realtime PCR Master Mix (Toyobo Life Science), containing 0.3 µM of each primer pair. The primer pairs for amplifying the human CDC45 and GAPDH transcripts were hCDC45-820: GACTGCACACGGATCTCCTT/AhCDC45-949: TCTGTCCATGCACAGACCAC and hGAPDH556/hGAPDH642 (20–22), respectively. Amplification was carried out initially for 1 min at 95°C, followed by 40 cycles at 95°C (15 sec) and 58°C (30 sec). Quantitative PCR analysis for each sample was carried out in triplicate. Relative gene expression values were obtained by normalizing threshold cycle (CT) values of target genes in comparison with CT values of the GAPDH gene using the 2−ΔΔCq method (26).
Statistical analysis
Standard deviations (S.D.) for each data were calculated and results are shown as means ± S.D. from three independent experiments. Statistical analyses were performed with the Student's t-test and asterisks indicate values of *P<0.05, **P<0.01 and ***P<0.005. P<0.05 was considered to indicate a statistically significant difference.
Results
Characterization of the human CDC45 promoter region
Duplicated GGAA motifs in the HELB and MCM4 promoters respond to Rsv (20,21), which can up-regulate the NAD+/NADPH ratio in HeLa S3 cells (27). The HELB is known to interact with CDC45 that associates with MCM helicase to develop the CDC45-MCM-GINS complex (1,12). To examine whether the CDC45 promoter responds to Rsv accompanied with the HELB and MCM4 promoter, the present study amplified and isolated the 556-bp of the 5′-flanking sequence of the CDC45 gene by PCR. Sequence analysis revealed that the pGL4-CDC45-556 contained a nucleotide identical to NCBI Sequence ID NC_000022.11 (nucleotide from 19419724-19479679) and that it covers the sequence of the most upstream 5′ end of the cDNA (Sequence IDs: XM_011530416.1 and XM_024452278.1, for CDC45 gene transcript variants X2 and X3, respectively and XM_011530417.3 and XM_011530418.3, for transcript variants X4 and X5, respectively; GENE ID, CDC45: 8318). This 556-bp region also contains a 5′ upstream end of the UFD1 mRNAs (sequence ID: NM_001035247.3, NM_005659.7 and NM_001362910.2; GENE ID, UFD1: 7253) in a reverse orientation to that of the CDC45 gene. The TSS was tentatively set as +1 at the most upstream 5′ end of the CDC45 transcript variants X2 and X3. The JASPAR2020 database program (jaspar.genereg.net/) indicated that the consensus recognition sequences of several known transcription factors are present within the 556-bp (Fig. 1A). This DNA sequence has no obvious TATA box or CCAAT motif but contains putative binding sites of ZNF93 (−321 to −307), ETS family (−275 to −266), ZNF28 (−246 to −237), SOX10 (−232 to −227, −55 to −50, −30 to −25), ZNF143 (−35 to −20), SOX18 (−31 to −24), YY1 (+2 to +7), FOXC1 (+125 to +132) and SPI1 (+166 to +171). To examine whether the 556-bp DNA fragment functioned as a promoter, Luc reporter plasmids, pGL4-HDHB (20), pGL4-MCM4 (21) and pGL4-CDC45-556, were transiently transfected into HeLa S3 cells. All the relative Luc activities of the plasmids-transfected cells increased after the addition of Rsv to the cell culture (Fig. 1B). Based on this observation, it was decided to examine the CDC45 gene/protein expression and promoter activity.
Effects of Rsv on CDC45 gene expression and its protein amount in HeLa S3 cells
Next, total RNAs were extracted from cells after adding Rsv to the culture medium and RT-qPCR was carried out (Fig. 2). The relative gene expression of CDC45 compared with that of the GAPDH gene increased approximately two-fold at 2 to 4 h after Rsv treatment. western blotting showed that the amount of CDC45 protein accumulated from 16 to 48 h after the treatment (Fig. 3).
Determination of Rsv-response element(s) in the CDC45 promoter
To examine the Rsv-responsive sequence, deletion from the 5′ and 3′ ends of the 556-bp CDC45 promoter region was introduced into the pGL4-CDC45-556 (Fig. 4A and B). The positive response to Rsv was observed in the cells that were transfected with pGL4-CDC45-D5. On the other hand, no apparent Luc activity was detected in pGL4-CDC45-D6-transfected cells (Fig. 4A), indicating that the region from −96 to −6 functions as a CDC45 gene promoter that positively responds to Rsv. In addition, comparing the Luc activities of the cells transfected with pGL4-CDC45-D4 and -D5, it was suggested that the region from −55 to +12 is essentially required for CDC45 promoter activity and its positive response to Rsv (Fig. 4B). Because the deletions from −358 to −299 or −248 (Fig. 4A) and from +198 to +159 (Fig. 4B) gave higher Luc activities, these regions may have negative regulatory element(s). The deletion from +158 to +104 from D11 and D12 constructs raised the basal promoter activity, suggesting that the 56 nucleotide contains negative elements) (Fig. 4C). Other deletions both from the 5′- and 3′- were examined in a similar transfection experiment (Fig. 4D). However, apparent Luc activities with positive response to Rsv were observed in cells that were transfected by these plasmids, including pGL4-CDC45-D54, which has the shortest 108-bp sequence. The obtained results totally showed that the region from −96-+12 functions as a minimum promoter that has Rsv response.
Introduction of point mutations on the CDC45 promoter
To indicate the Rsv-responsive sequence more precisely, point mutations were introduced to the CDC45 promoter (Fig. 5). To examine the contribution of the GGAA (TTCC) motifs (ACC GGAAGT; −275 to −267 and ATACTTTCCCTGAGGGTTCCCAGTG; +124 to +148) and the GC-box (GGAGGGGGGTGCC; −249 to −237) to the drug response, point mutations were introduced on pGL4-CDC45-442 and −399 (Fig. 5A). Transfection and Luc assay showed that most mutation-introduced plasmids had a positive response to Rsv. However, the response was much reduced in pGL4-CDC45-399-M2 and -M2M-transfected cells (Fig. 5A), suggesting that the GC-box, which was predicted as ZNF28 recognition sequence by JASPAR2020 program, plays a part in the regulation of CDC45 transcription.
Next, the minimum core Rsv-responding 108-bp from −96 to +12 was examined to see whether it contained a Rsv response element(s) (Fig. 5B). Previous studies on the human HELB, MCM4 and TP53 gene promoters showed that a GGAA (TTCC) motif plays a primarily important role in the response to Rsv (20–22). Therefore, it was hypothesized that the GGAA (TTCC) core motif also regulates the CDC45 promoter activity. However, no TF-binding sites with GGAA (TTCC) were indicated by the JASPAR2020 program when the threshold was set at 98% (Fig. 1A). Therefore, the present study examined setting the threshold at 95%. This time, the putative RELB binding sequence, which is located just 3′-downstream of the MEIS1 binding motif was indicated (Fig. 5B). Compared with the wild type pGL4-CDC45-D54, mutation in the pGL4-CDC45-D54_M3 reduced the Luc activity, but a positive response to Rsv was still observed (Fig. 5B). On the other hand, the response was completely abolished in the pGL4-CDC45-D54_M4. These results suggested that the sequence between putative MEIS1 and RELB recognition sites is of primary importance for the CDC45 promoter activity and the positive response to Rsv.
Discussion
The present study showed that treatment with Rsv (20 µM) induced CDC45 gene and protein expression in HeLa S3 cells. Deletion and mutation analyses revealed that the putative RELB binding sequence was required for the CDC45 promoter activity to positively respond to Rsv.
The CDC45-UFD1 bidirectional promoter has been isolated and characterized to suggest a putative TATA-box within the region (28). Although the TATA-like sequence, TTTTATAGG (from −129 to −122) is contained in the pGL4-CDC45-D5 construct, it does not have promoter activity (Figs. 4 and 5B), indicating that the sequence is not essential for CDC45 promoter in HeLa S3 cells. The 556-bp, containing TSSs of both genes, possesses a duplicated GGAA (TTCC) motif, which is contained in the promoter regions of many genes that encode DNA repair and genome maintenance factors (16,29). The duplicated GGAA motif in the human TP53 promoter has been shown to have an essential role to respond to Rsv in HeLa S3 cells (22). However, the duplicated GGAA (TTCC) (from +124 to +148) in the 556-bp of the human CDC45 promoter seems to be non-essential (Fig. 5A). The GC-box, which is a Sp1-recognitionsequence that is commonly contained in the HELB and MCM4 promoter regions, serves a part in the response to Rsv (20,21). However, the Rsv-responding sequence from −96 to +12 (Fig. 5B) does not contain any GC-boxes or GC-box like motifs. In the present study, the functional transcription promoter with the response to Rsv was shown to be present in the sequence 5′-CAGTATTCCCCTCC-3′ (−88 to −75), which overlaps with the MEIS1 and RELB recognition motifs (Fig. 5B). MEIS1 gene expression is prominently suppressed when THP-1 cells are induced to differentiate into monocyte-macrophage-like cells by 12-O-tetradecanoylphorbol-13-acetate (TPA) (30). In murine myeloid cells, MEIS1 acts as a suppressor of granulocyte colony stimulation factor-induced differentiation (31). The amount of RELB protein increases in granulocyte macrophage colony stimulation factor-induced macrophage cells only following stimulation by lipopolysaccharide (32). In addition, RELB is required for TNF-induced differentiation of bone marrow cells into M1 macrophages in mice (33). Our previous studies indicated that the duplicated GGAA-motif is responsible for the activation of the E2F4 and ZNFX1 genes during TPA-induced macrophage-like differentiation of HL-60 cells (34,35). In HeLa S3 cells, the Sp1/PU.1 ratio is notably increased following the Rsv treatment (21). It should be determined whether the RELB/MEIS1 ratio in HeLa S3 cells is increased in response to Rsv and if they are competing to bind to the Rsv response element in the CDC45 promoter.
The natural compound Rsv has been shown to upregulate expression of the HELB and MCM4 genes and its encoded proteins in HeLa S3 cells (20,21). The human HELB (HDHB) gene encodes a DNA replication-associated helicase (36), which binds to DNA double-strand breaks to inhibit DNA end resection (7). In addition, the HELB protein is known to interact with the CDC45 at initiation of DNA replication (10,37). Notably, the MCM complex, whose structure was revealed by cryo-electron microscopy (38), associates with CDC45 and GINS (1,39). The timing of CMG complex formation at the origin of replication should be limited to initiate DNA replication at a suitable time (40). The duplicated GGAA (TTCC) motifs are not only present in the 5′ upstream regions of the CDKN1A, RB1, TP53 and MCM4 genes (21,22), but also in that of the GINS1, GINS3 and GINS4 genes (41). Expression of genes encoding proteins that regulate entering the S-phase could be accurately regulated by GGAA-recognizing TFs.
The present study showed that human CDC45 gene promoter can be activated by Rsv in HeLa S3 cells. CDC45 is a component of CMG helicase which is essential for responses to replicative stress and stability of mammalian genomes (37,42). If, in some cancer cells, the CMG helicase play an important role as a tumor suppressor, maintaining required expression level would stop aberrant proliferation. By contrast, in other types of cancer, hyper expression of the CDC45 gene may be harmful, functioning as an oncogenic factor (43). In this case, the CDC45 might be one of the targets, inhibition of which can lead to apoptosis or programmed cell death. Rsv can prolong the life span of organisms (44,45) and has been revealed to have beneficial effects for health (46). Further investigations are required to elucidate the mechanisms by which Rsv-induced signals regulate DNA replication/repair-associated gene expression. The present study not only examine biological effect of the Rsv, but also suggested a molecular mechanism how Rsv affects transcription of CDC45 gene. Evaluation of the efficacies of other candidate drugs, gene expression vectors and nucleotides, including miRNAs, the multiple transfection assay would be useful to indicate which gene promoters are activated. The limitation of the present study is that it cannot be directly applied to diagnosis with tissue samples obtained by biopsy. However, it could be applied on iPS cells or patient-derived cell lines. Another concern is that the experimental system to analyze multiple gene promoter activities is only applicable with the use of/verification in only one cell line at the same time. Although it needs to be improved, this multiple promoter analysis, an easy, reproducible and cost-effective method, which does not always need transfection-efficiency estimation, can suggest which drugs or gene expression vectors should be used for the treatment.
Acknowledgements
The authors would like to thank Mr. Hiroyasu Nakao (Tokyo University of Science, Noda, Chiba, JAPAN) and Ms. Marie Nose (Tokyo University of Science, Noda, Chiba, JAPAN) for their excellent technical assistance. The present study was performed under the permission of recombinant DNA experimental committee admission nos. 1825 and 1917 of Tokyo University of Science.
Funding
The present study was supported in part by JSPS KAKENHI grant no. 24510270 and a Research Fellowship from the Research Center for RNA Science, RIST, Tokyo University of Science.
Availability of data and materials
The data generated in the present study may be requested from the corresponding author.
Authors' contributions
JA and FU confirm the authenticity of all the raw data. JA and HK constructed the Luc reporter plasmid and performed experiments and analyzed the data (transfection assay, RT-qPCR and western blotting). FU interpreted the data and wrote the manuscript. ST collected and analyzed/interpreted the data. TM, YO and MA interpreted the data and edited the manuscript. All authors have read and approved the final version of the manuscript.
Ethics approval and consent to participate
Not applicable.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Glossary
Abbreviations
Abbreviations:
CT |
threshold cycle |
DMEM |
Dulbecco's modified Eagle's medium |
FBS |
fetal bovine serum |
Luc |
luciferase |
MCM |
minichromosome maintenance |
Rsv |
trans-resveratrol |
RT-qPCR |
reverse transcription-quantitative PCR |
TF |
transcription factor |
TSS |
transcription start site |
References
Simon AC, Sannino V, Costanzo V and Pellegrini L: Structure of human Cdc45 and implications for CMG helicase function. Nat Commun. 7:116382016. View Article : Google Scholar : PubMed/NCBI | |
Szambowska A, Tessmer I, Prus P, Schlott B, Pospiech H and Grosse F: Cdc45-induced loading of human RPA onto single-stranded DNA. Nucleic Acids Res. 45:3217–3230. 2017.PubMed/NCBI | |
Krastanova I, Sannino V, Amenitsch H, Gileadi O, Pisani FM and Onesti S: Structural and functional insights into the DNA replication factor Cdc45 reveal an evolutionary relationship to the DHH family of phosphoesterases. J Biol Chem. 287:4121–4128. 2012. View Article : Google Scholar : PubMed/NCBI | |
Szambowska A, Tessmer I, Kursula P, Usskilat C, Prus P, Pospiech H and Grosse F: DNA binding properties of human Cdc45 suggest a function as molecular wedge for DNA unwinding. Nucleic Acids Res. 42:2308–2319. 2014. View Article : Google Scholar : PubMed/NCBI | |
Bruck I and Kaplan DL: Cdc45 protein-single-stranded DNA interaction is important for stalling the helicase during replication stress. J Biol Chem. 288:7550–7563. 2013. View Article : Google Scholar : PubMed/NCBI | |
Can G, Kauerhof AC, Macak D and Zegerman P: Helicase subunit Cdc45 targets the checkpoint kinase Rad53 to both replication initiation and elongation complexes after fork stalling. Mol Cell. 73:562–573.e3. 2019. View Article : Google Scholar : PubMed/NCBI | |
Tkáč J, Xu G, Adhikary H, Young JTF, Gallo D, Escribano-Díaz C, Krietsch J, Orthwein A, Munro M, Sol W, et al: HELB is a feedback inhibitor of DNA end resection. Mol Cell. 61:405–418. 2016. View Article : Google Scholar : PubMed/NCBI | |
Guler GD, Liu H, Vaithiyalingam S, Arnett DR, Kremmer E, Chazin WJ and Fanning E: Human DNA helicase B (HDHB) binds to replication protein A and facilitates cellular recovery from replication stress. J Biol Chem. 287:6469–6481. 2012. View Article : Google Scholar : PubMed/NCBI | |
Liu H, Yan P and Fanning E: Human DNA helicase B functions in cellular homologous recombination and stimulates Rad51-mediated 5′-3′ heteroduplex extension in vitro. PLoS One. 10:e01168522015. View Article : Google Scholar : PubMed/NCBI | |
Gerhardt J, Guler GD and Fanning E: Human DNA helicase B interacts with the replication initiation protein Cdc45 and facilitates Cdc45 binding onto chromatin. Exp Cell Res. 334:283–293. 2015. View Article : Google Scholar : PubMed/NCBI | |
Huang J, Zhang J, Bellani MA, Pokharel D, Gichimu J, James RC, Gali H, Ling C, Yan Z, Xu D, et al: Remodeling of interstrand crosslink proximal replisomes is dependent on ATR, FANCM, and FANCD2. Cell Rep. 27:1794–1808.e5. 2019. View Article : Google Scholar : PubMed/NCBI | |
Aparicio T, Guillou E, Coloma J, Montoya G and Méndez J: The human GINS complex associates with Cdc45 and MCM and is essential for DNA replication. Nucleic Acids Res. 37:2087–2095. 2009. View Article : Google Scholar : PubMed/NCBI | |
Köhler C, Koalick D, Fabricius A, Parplys AC, Borgmann K, Pospiech H and Grosse F: Cdc45 is limiting for replication initiation in humans. Cell Cycle. 15:974–985. 2016. View Article : Google Scholar : PubMed/NCBI | |
Chen M, Gutierrez GJ and Ronai ZA: Ubiquitin-recognition protein Ufd1 couples the endoplasmic reticulum (ER) stress response to cell cycle control. Proc Natl Acad Sci USA. 108:9119–9124. 2011. View Article : Google Scholar : PubMed/NCBI | |
Maric M, Mukherjee P, Tatham MH, Hay R and Labib K: Ufd-Npl4 recruit Cdc48 for disassembly of ubiquitylated CMG helicase at the end of chromosome replication. Cell Rep. 18:3033–3042. 2017. View Article : Google Scholar : PubMed/NCBI | |
Uchiumi F, Miyazaki S and Tanuma S: The possible functions of duplicated ets (GGAA) motifs located near transcription start sites of various human genes. Cell Mol Life Sci. 68:2039–2051. 2011. View Article : Google Scholar : PubMed/NCBI | |
FitzGerald PC, Shlyakhtenko A, Mir AA and Vinson C: Clustering of DNA sequences in human promoters. Genome Res. 14:1562–1574. 2004. View Article : Google Scholar : PubMed/NCBI | |
Wei GH, Badis G, Berger MF, Kivioja T, Palin K, Enge M, Bonke M, Jolma A, Varjosalo M, Gehrke AR, et al: Genome-wide analysis of ETS-family DNA-binding in vitro and in vivo. EMBO J. 29:2147–2160. 2010. View Article : Google Scholar : PubMed/NCBI | |
Cheng D, Zhao Y, Wang S, Jia W, Kang J and Zhu J: Human telomerase reverse transcriptase (hTERT) transcription requires Sp1/Sp3 binding to the promoter and a permissive chromatin environment. J Biol Chem. 290:30193–30203. 2015. View Article : Google Scholar : PubMed/NCBI | |
Uchiumi F, Arakawa J, Iwakoshi S, Ishibashi S and Tanuma S: Characterization of the 5′-flanking region of the human DNA helicase B (HELB) gene and its response to trans-resveratrol. Sci Rep. 6:245102016. View Article : Google Scholar : PubMed/NCBI | |
Uchiumi F, Katsuda C, Akui M, Kusaka M, Tanaka M, Asai M and Tanuma SI: Effect of the natural compound trans-resveratrol on human MCM4 gene transcription. Oncol Rep. 44:283–292. 2020. View Article : Google Scholar : PubMed/NCBI | |
Uchiumi F, Shoji K, Sasaki Y, Sasaki M, Sasaki Y, Oyama K, Sugisawa S and Tanuma S: Characterization of the 5′-flanking region of the human TP53 gene and its response to the natural compound, resveratrol. J Biochem. 159:437–447. 2016. View Article : Google Scholar : PubMed/NCBI | |
Tanuma S and Kanai Y: Poly(ADP-ribosyl)ation of chromosomal proteins in the HeLa S3 cell cycle. J Biol Chem. 257:6565–6570. 1982. View Article : Google Scholar : PubMed/NCBI | |
Uchiumi F, Watanabe T, Hasegawa S, Hoshi T, Higami Y and Tanuma S: The effect of resveratrol on the werner syndrome RecQ helicase gene and telomerase activity. Curr Aging Sci. 4:1–7. 2011. View Article : Google Scholar : PubMed/NCBI | |
Uchiumi F, Larsen S and Tanuma S: Application of DEAE-dextran to an efficient gene transfer system. Dextran: Chemical Structure, Application and Potential Side Effects. Figgs GP: Nova Science Publishers; Hauppauge, NY: pp. 143–156. 2014 | |
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
Takihara Y, Sudo D, Arakawa J, Takahashi M, Sato A, Tanuma S and Uchiumi F: Nicotinamide adenine dinucleotide (NAD+) and cell aging. New Research on Cell Aging and Death. Strakoš R and Lorens B: Nova Science Publishers; Hauppauge, NY: pp. 131–158. 2018 | |
Igaki H, Nakagawa K, Aoki Y, Ohtomo K, Kukimoto I and Kanda T: Characterization of the bi-directional transcriptional control region between the human UFD1L and CDC45 genes. Biochem Biophys Res Commun. 283:569–576. 2001. View Article : Google Scholar : PubMed/NCBI | |
Uchiumi F, Larsen S and Tanuma S: Biological systems that control transcription of DNA repair and telomere maintenance-associated genes. New Research in Directions in DNA Repair. Chen C: InTech Open; London: pp. 309–325. 2013 | |
Martino V, Bianchera A, Reia L, Bussolati O, Fazzina R, Marino F, Montemurro L, Tonelli R, Pession A, Gazzola GC and Sala R: Down regulation of HOXA4, HOXA7, HOXA10, HOXA11 and MEIS1 during monocyte-macrophage differentiation in THP-1 cells. Mol Med Rep. 2:241–244. 2009.PubMed/NCBI | |
Calvo KR, Knoepfler PS, Sykes DB, Pasillas MP and Kamps MP: Meis1a suppresses differentiation by G-CSF and promotes proliferation by SCF: Potential mechanisms of cooperativity with Hox9 in myeloid leukemia. Proc Natl Acad Sci USA. 98:13120–13125. 2001. View Article : Google Scholar : PubMed/NCBI | |
Li T, Morgan MJ, Choksi S, Zhang Y, Kim YS and Liu ZG: MicroRNAs modulate the noncanonical transcription factor NF-kappaB pathway by regulating expression of the kinase IKKalpha during macrophage differentiation. Nat Immunol. 11:799–805. 2010. View Article : Google Scholar : PubMed/NCBI | |
Zhao Z, Hou X, Yin X, Li Y, Duan R, Boyce BF and Yao Z: TNF induction of NF-kB RelB enhances RANKL-induced osteoclastogenesis by promoting inflammatory macrophage differentiation but also limits it through suppression of NFATc1 expression. PLoS One. 10:e01357282015. View Article : Google Scholar : PubMed/NCBI | |
Hamada H, Goto Y, Arakawa J, Murayama E, Ogawa Y, Konno M, Oyama T, Asai M, Sato A, Tanuma S and Uchiumi F: Characterization of the human E2F4 promoter region and its response to 12-O-tetradecanoylphorbol-13-acetate. J Biochem. 166:363–373. 2019. View Article : Google Scholar : PubMed/NCBI | |
Hamada H, Yamamura M, Ohi H, Kobayashi Y, Niwa K, Oyama T, Mano Y, Asai M, Tanuma SI and Uchiumi F: Characterization of the human zinc finger nfx-1-type containing 1 encoding ZNFX1 gene and its response to 12-O-tetradecanoyl-13-acetate in HL-60 cells. Int J Oncol. 55:869–904. 2019. | |
Taneja P, Gu J, Peng R, Carrick R, Uchiumi F, Ott RD, Gustafson E, Podust VN and Fanning E: A dominant-negative mutant of human DNA helicase B blocks the onset of chromosomal DNA replication. J Biol Chem. 277:40853–40861. 2002. View Article : Google Scholar : PubMed/NCBI | |
Hazeslip L, Zafar MK, Chauhan MZ and Byrd AK: Genome maintenance by DNA helicase B. Genes (Basel). 11:5782020. View Article : Google Scholar : PubMed/NCBI | |
Miller TCR, Locke J, Greiwe JF, Diffley JFX and Costa A: Mechanism of head-to-head MCM double-hexamer formation revealed by cryo-EM. Nature. 575:704–710. 2019. View Article : Google Scholar : PubMed/NCBI | |
Douglas ME, Ali FA, Costa A and Diffley JFX: The mechanism of eukaryotic CMG helicase activation. Nature. 555:265–268. 2018. View Article : Google Scholar : PubMed/NCBI | |
Araki H: Molecular mechanisms of DNA replication. DNA Replication, Recombination, and Repair. Hanaoka F and Sugasawa K: Springer; Japan, Tokyo: pp. 3–22. 2016, View Article : Google Scholar | |
Uchiumi F: Transcriptional regulatory systems of the human helicases. Advances in Medicine and Biology. Berhardt LV: Nova Science Publishers; Hauppauge, NY: pp. 115–153. 2020 | |
Xiang S, Reed DR and Alexandrow MG: The CMG helicase and cancer: A tumor ‘engine’ and weakness with missing mutations. Oncogene. 42:473–490. 2023. View Article : Google Scholar : PubMed/NCBI | |
Lu Y, Chen X, Liu F, Yu H, Zhang Y, Du K, Nan Y and Huang Q: Systematic pan-cancer analysis identifies CDC45 as having an oncogenic role in human cancers. Oncol Rep. 48:1852022. View Article : Google Scholar : PubMed/NCBI | |
Stefani M, Markus MA, Lin RC, Pinese M, Dawes IW and Morris BJ: The effect of resveratrol on a cell model of human aging. Ann N Y Acad Sci. 1114:407–418. 2007. View Article : Google Scholar : PubMed/NCBI | |
Kaeberlein M: Resveratrol and rapamycin: Are they anti-aging drugs? Bioessays. 32:96–99. 2010. View Article : Google Scholar : PubMed/NCBI | |
Uchiumi F, Arakawa J, Takihara Y, Akui M, Ishibashi S and Tanuma S: The effect of trans-resveratrol on the expression of the human DNA-repair associated genes. Int Mol Med. 3:783–792. 2016. |